a brief history of creation science and the search for the origin of life

Download Book A Brief History Of Creation Science And The Search For The Origin Of Life in PDF format. You can Read Online A Brief History Of Creation Science And The Search For The Origin Of Life here in PDF, EPUB, Mobi or Docx formats.

A Brief History Of Creation

Author : Bill Mesler
ISBN : 0393083551
Genre : Science
File Size : 87. 54 MB
Format : PDF, Kindle
Download : 861
Read : 1195

Download Now

The epic story of the scientists through the ages who have sought answers to life s biggest mystery: How did it begin?"

A Brief History Of Creation Science And The Search For The Origin Of Life

Author : Bill Mesler
ISBN : 9780393248548
Genre : Science
File Size : 38. 12 MB
Format : PDF, ePub
Download : 437
Read : 1088

Download Now

The epic story of the scientists through the ages who have sought answers to life’s biggest mystery: How did it begin? How did life begin? It is perhaps the most important question science has ever asked. Over the centuries, the search for an answer has been entwined with some of science’s most revolutionary advances including van Leeuwenhoek’s microscope, Darwin’s theory of evolution, and Crick and Watson’s unveiling of DNA. Now, in an age of genetic engineering and space exploration, some scientists believe they are on the verge of creating life from nonliving elements and that our knowledge of the potential for life on other planets is ever-expanding. In the midst of these exciting developments, A Brief History of Creation provides an essential and illuminating history of Western science, tracing the trials and triumphs of the iconoclastic scientists who have sought to uncover the mystery of how life first came to be. Authors Bill Mesler and H. James Cleaves II examine historical discoveries in the context of philosophical debates, political change, and our evolving understanding of the complexity of biology. The story they tell is rooted in metaphysical arguments, in a changing understanding of the age of the Earth, and even in the politics of the Cold War. It has involved exploration into the inner recesses of our cells and scientific journeys to the farthest reaches of outer space. This elegantly written narrative culminates in an analysis of modern models for life’s genesis, such as the possibility that some of the earliest life was composed of little more than RNA, and that life arose around deep-sea hydrothermal vents or even on other planets, only to be carried to the Earth on meteorites. Can we ever conclusively prove how life began? A Brief History of Creation is a fascinating exploration not only of the origin-of-life question but of the very nature of scientific objectivity and the process of scientific discovery.


Author : Adam Rutherford
ISBN : 9780141970226
Genre : Science
File Size : 63. 64 MB
Format : PDF, ePub, Mobi
Download : 626
Read : 314

Download Now

'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

A Brief History Of Everyone Who Ever Lived

Author : Adam Rutherford
ISBN : 9780297609391
Genre : Science
File Size : 85. 46 MB
Format : PDF, ePub, Docs
Download : 164
Read : 1058

Download Now

This is a story about you. It is the history of who you are and how you came to be. It is unique to you, as it is to each of the 100 billion modern humans who have ever drawn breath. But it is also our collective story, because in every one of our genomes we each carry the history of our species - births, deaths, disease, war, famine, migration and a lot of sex. Since scientists first read the human genome in 2001 it has been subject to all sorts of claims, counterclaims and myths. In fact, as Adam Rutherford explains, our genomes should be read not as instruction manuals, but as epic poems. DNA determines far less than we have been led to believe about us as individuals, but vastly more about us as a species. In this captivating journey through the expanding landscape of genetics, Adam Rutherford reveals what our genes now tell us about history, and what history tells us about our genes. From Neanderthals to murder, from redheads to race, dead kings to plague, evolution to epigenetics, this is a demystifying and illuminating new portrait of who we are and how we came to be.


Author : Yuval Noah Harari
ISBN : 9780062316103
Genre : Science
File Size : 90. 84 MB
Format : PDF, Kindle
Download : 795
Read : 1324

Download Now

New York Times Bestseller From a renowned historian comes a groundbreaking narrative of humanity’s creation and evolution—a #1 international bestseller—that explores the ways in which biology and history have defined us and enhanced our understanding of what it means to be “human.” One hundred thousand years ago, at least six different species of humans inhabited Earth. Yet today there is only one—homo sapiens. What happened to the others? And what may happen to us? Most books about the history of humanity pursue either a historical or a biological approach, but Dr. Yuval Noah Harari breaks the mold with this highly original book that begins about 70,000 years ago with the appearance of modern cognition. From examining the role evolving humans have played in the global ecosystem to charting the rise of empires, Sapiens integrates history and science to reconsider accepted narratives, connect past developments with contemporary concerns, and examine specific events within the context of larger ideas. Dr. Harari also compels us to look ahead, because over the last few decades humans have begun to bend laws of natural selection that have governed life for the past four billion years. We are acquiring the ability to design not only the world around us, but also ourselves. Where is this leading us, and what do we want to become? Featuring 27 photographs, 6 maps, and 25 illustrations/diagrams, this provocative and insightful work is sure to spark debate and is essential reading for aficionados of Jared Diamond, James Gleick, Matt Ridley, Robert Wright, and Sharon Moalem.

Origins Of Life

Author : Fazale Rana
ISBN : 1576833445
Genre : Religion
File Size : 84. 15 MB
Format : PDF, ePub, Mobi
Download : 113
Read : 237

Download Now

Imagine primordial Earth, a churning cauldron of liquefied rock. Steaming, seething -- a vast desolate wasteland, inhospitable to life. Yet somehow first life appeared. Maybe chemicals in a primordial soup spontaneously spawned a single-celled creature that continued to evolve. Or perhaps a transcendent Creator formed and nurtured the initial life forms. To determine what really happened requires a framework to evaluate the evidence. For the first time in print, Dr. Rana and Dr. Ross present a scientific model for the creation of first life on Earth -- a model based on the Bible. They present testable predictions for this life-origins scenario and for the competing naturalistic scenarios. Which model withstands the rigorous scrutiny of science and the tests of time? The one that does gives insight to a deeper question: Why would the first life forms precede human life by billions of years? Book jacket.

A Universe From Nothing

Author : Lawrence M. Krauss
ISBN : 9781451624472
Genre : Science
File Size : 37. 60 MB
Format : PDF, Docs
Download : 484
Read : 987

Download Now

Bestselling author and acclaimed physicist Lawrence Krauss offers a paradigm-shifting view of how everything that exists came to be in the first place. “Where did the universe come from? What was there before it? What will the future bring? And finally, why is there something rather than nothing?” One of the few prominent scientists today to have crossed the chasm between science and popular culture, Krauss describes the staggeringly beautiful experimental observations and mind-bending new theories that demonstrate not only can something arise from nothing, something will always arise from nothing. With a new preface about the significance of the discovery of the Higgs particle, A Universe from Nothing uses Krauss’s characteristic wry humor and wonderfully clear explanations to take us back to the beginning of the beginning, presenting the most recent evidence for how our universe evolved—and the implications for how it’s going to end. Provocative, challenging, and delightfully readable, this is a game-changing look at the most basic underpinning of existence and a powerful antidote to outmoded philosophical, religious, and scientific thinking.

Top Download:

Best Books