a brief history of creation science and the search for the origin of life

Download Book A Brief History Of Creation Science And The Search For The Origin Of Life in PDF format. You can Read Online A Brief History Of Creation Science And The Search For The Origin Of Life here in PDF, EPUB, Mobi or Docx formats.

A Brief History Of Creation Science And The Search For The Origin Of Life

Author : Bill Mesler
ISBN : 9780393248548
Genre : Science
File Size : 71. 52 MB
Format : PDF, Mobi
Download : 939
Read : 237

Get This Book


The epic story of the scientists through the ages who have sought answers to life’s biggest mystery: How did it begin? In this essential and illuminating history of Western science, Bill Mesler and H. James Cleaves II seek to answer the most crucial question in science: How did life begin? They trace the trials and triumphs of the iconoclastic scientists who have sought to solve the mystery, from Darwin’s theory of evolution to Crick and Watson’s unveiling of DNA. This fascinating exploration not only examines the origin-of-life question, but also interrogates the very nature of scientific discovery and objectivity.

Evolution F R Dummies

Author : Greg Krukonis
ISBN : 9783527669004
Genre : Science
File Size : 41. 56 MB
Format : PDF, ePub
Download : 601
Read : 1198

Get This Book


Von Darwin bis DNA – Ihr Wegweiser durch die Evolution Von Ihrem Körperbau bis zu Ihrem Verhalten bei der Partnerwahl – all Ihre vererbbaren Eigenschaften sind wie bei allen Lebewesen durch die Evolution bestimmt. Aber was ist Evolution überhaupt? Was treibt sie an? In diesem Buch erfahren Sie alles, was Sie über Evolution wissen müssen: Was genetische Variabilität ist, wie neue Arten entstehen, welchen Evolutionsvorteil soziales Verhalten bringt und vieles, vieles mehr. Greg Krukonis und Tracy Barr nehmen Sie mit auf eine spannende Reise durch die Geschichte der Evolution – von Darwins Theorie bis zu den neuesten wissenschaftlichen Erkenntnissen.

Eine Kurze Geschichte Der Menschheit

Author : Yuval Noah Harari
ISBN : 9783641104986
Genre : History
File Size : 80. 43 MB
Format : PDF, ePub
Download : 702
Read : 991

Get This Book


Krone der Schöpfung? Vor 100 000 Jahren war der Homo sapiens noch ein unbedeutendes Tier, das unauffällig in einem abgelegenen Winkel des afrikanischen Kontinents lebte. Unsere Vorfahren teilten sich den Planeten mit mindestens fünf weiteren menschlichen Spezies, und die Rolle, die sie im Ökosystem spielten, war nicht größer als die von Gorillas, Libellen oder Quallen. Vor 70 000 Jahren dann vollzog sich ein mysteriöser und rascher Wandel mit dem Homo sapiens, und es war vor allem die Beschaffenheit seines Gehirns, die ihn zum Herren des Planeten und zum Schrecken des Ökosystems werden ließ. Bis heute hat sich diese Vorherrschaft stetig zugespitzt: Der Mensch hat die Fähigkeit zu schöpferischem und zu zerstörerischem Handeln wie kein anderes Lebewesen. Anschaulich, unterhaltsam und stellenweise hochkomisch zeichnet Yuval Harari die Geschichte des Menschen nach und zeigt alle großen, aber auch alle ambivalenten Momente unserer Menschwerdung.

Big History

Author : David Christian
ISBN : 9783446261426
Genre : History
File Size : 68. 55 MB
Format : PDF, ePub
Download : 218
Read : 604

Get This Book


Der Big Bang war der heißeste Augenblick der Weltgeschichte. Der Rest ist Abkühlung. Und die hatte Folgen: Atome und Sterne entstanden, die Erde und wir. Eingebettet in die Geschichte des Universums ist auch die Geschichte der Menschheit. David Christian erzählt die Historie der Welt anhand von acht Schwellenmomenten: von der Entstehung des Lebens bis zur Fotosynthese, von der Sprache bis zum menschgemachten Klimawandel. Sein Buch ist eine brillante Synthese der Erkenntnisse aus Astronomie, Biologie, Chemie und Physik. Und eine atemberaubende moderne Ursprungsgeschichte, die mit einem Ausblick auf die Zukunft endet, in der wir endlich die Verantwortung für den Planeten Erde übernehmen müssen.

The Fifth Miracle

Author : Paul Davies
ISBN : 9780684863092
Genre : Philosophy
File Size : 89. 95 MB
Format : PDF, ePub
Download : 583
Read : 294

Get This Book


Explains our current knowledge about life's origins, focusing on recently discovered "superbugs" which may have arrived here on asteroids, and arguing that life grew from primitive information-processing systems.

Homo Deus

Author : Yuval Noah Harari
ISBN : 9783406704024
Genre : Social Science
File Size : 42. 59 MB
Format : PDF, Kindle
Download : 339
Read : 216

Get This Book


In seinem Kultbuch „Eine kurze Geschichte der Menschheit“ erklärte Yuval Noah Harari, wie unsere Spezies die Erde erobern konnte. In „Homo Deus“ stößt er vor in eine noch verborgene Welt: die Zukunft. Was wird mit uns und unserem Planeten passieren, wenn die neuen Technologien dem Menschen gottgleiche Fähigkeiten verleihen – schöpferische wie zerstörerische – und das Leben selbst auf eine völlig neue Stufe der Evolution heben? Wie wird es dem Homo Sapiens ergehen, wenn er einen technikverstärkten Homo Deus erschafft, der sich vom heutigen Menschen deutlicher unterscheidet als dieser vom Neandertaler? Was bleibt von uns und der modernen Religion des Humanismus, wenn wir Maschinen konstruieren, die alles besser können als wir? In unserer Gier nach Gesundheit, Glück und Macht könnten wir uns ganz allmählich so weit verändern, bis wir schließlich keine Menschen mehr sind.

Origin

Author : Dan Brown
ISBN : 9783732542215
Genre : Fiction
File Size : 84. 16 MB
Format : PDF, ePub, Mobi
Download : 688
Read : 900

Get This Book


ILLUMINATI, SAKRILEG, DAS VERLORENE SYMBOL und INFERNO - vier Welterfolge, die mit ORIGIN ihre spektakuläre Fortsetzung finden. Die Wege zur Erlösung sind zahlreich. Verzeihen ist nicht der einzige. Als der Milliardär und Zukunftsforscher Edmond Kirsch drei der bedeutendsten Religionsvertreter der Welt um ein Treffen bittet, sind die Kirchenmänner zunächst skeptisch. Was will ihnen der bekennende Atheist mitteilen? Was verbirgt sich hinter seiner "bahnbrechenden Entdeckung", das Relevanz für Millionen Gläubige auf diesem Planeten haben könnte? Nachdem die Geistlichen Kirschs Präsentation gesehen haben, verwandelt sich ihre Skepsis in blankes Entsetzen. Die Furcht vor Kirschs Entdeckung ist begründet. Und sie ruft Gegner auf den Plan, denen jedes Mittel recht ist, ihre Bekanntmachung zu verhindern. Doch es gibt jemanden, der unter Einsatz des eigenen Lebens bereit ist, das Geheimnis zu lüften und der Welt die Augen zu öffnen: Robert Langdon, Symbolforscher aus Harvard, Lehrer Edmond Kirschs und stets im Zentrum der größten Verschwörungen. Jetzt das eBook herunterladen und in wenigen Sekunden loslesen!

Eine Kurze Geschichte Der Zeit

Author : Stephen Hawking
ISBN : 9783644008618
Genre : Science
File Size : 59. 55 MB
Format : PDF, Kindle
Download : 262
Read : 995

Get This Book


Ist das Universum unendlich oder begrenzt? Hat die Raumzeit einen Anfang, den Urknall? Dehnt sie sich aus? Wird sie wieder in sich zusammenstürzen? Liefe die Zeit dann rückwärts? Welchen Platz im Universum nehmen wir ein? Und ist in den atemberaubenden Modellen der Kosmologen noch Platz für einen Gott? – Es sind existenzielle Fragen, mit denen sich Stephen Hawking befasst, Fragen, die Forschung und Lehre in den Zentren der modernen Physik ebenso bestimmen wie die Diskussion von Geisteswissenschaftlern. Dieses Meisterwerk eines Jahrhundert-Genies hat unsere Weltsicht verändert. Zugleich hat Stephen Hawking damit neue Maßstäbe für die Erklärung komplexer physikalischer Zusammenhänge gesetzt. In diesem Buch, weltweit inzwischen über zehn Millionen Mal verkauft, ist das Credo des großen Physikers enthalten und lebendig. «Der Physiker Stephen Hawking ist im Begriff, die Formel zu finden, die das Universum erklärt.» ZEIT-Magazin

Hidden Figures Unerkannte Heldinnen

Author : Margot Lee Shetterly
ISBN : 9783959676434
Genre : History
File Size : 33. 77 MB
Format : PDF, ePub
Download : 505
Read : 568

Get This Book


1943 stellt das Langley Memorial Aeronautical Laboratory der NACA,die später zur NASA wird, erstmalig afroamerikanische Frauen ein. "Menschliche Rechner" - unter ihnen Dorothy Vaughan, die 1953 Vorgesetzte der brillanten afroamerikanischen Mathematikerin Katherine Johnson wird. Trotz Diskriminierung und Vorurteilen, treiben sie die Forschungen der NASA voran und Katherine Johnsons Berechnungen werden maßgeblich für den Erfolg der Apollo-Missionen. Dies ist ihre Geschichte. "Mit dieser unglaublich mitreißenden und vielschichtigen Erzählung zeigt Shetterly ihr Können. Die Geschichte begeistert in allen Aspekten." Booklist

Creation

Author : Adam Rutherford
ISBN : 9780141970226
Genre : Science
File Size : 86. 42 MB
Format : PDF
Download : 951
Read : 502

Get This Book


'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

Top Download:

Best Books