a brief history of creation science and the search for the origin of life

Download Book A Brief History Of Creation Science And The Search For The Origin Of Life in PDF format. You can Read Online A Brief History Of Creation Science And The Search For The Origin Of Life here in PDF, EPUB, Mobi or Docx formats.

A Brief History Of Creation Science And The Search For The Origin Of Life

Author : Bill Mesler
ISBN : 9780393248548
Genre : Science
File Size : 83. 34 MB
Format : PDF, ePub, Docs
Download : 620
Read : 879

Download Now


The epic story of the scientists through the ages who have sought answers to life’s biggest mystery: How did it begin? In this essential and illuminating history of Western science, Bill Mesler and H. James Cleaves II seek to answer the most crucial question in science: How did life begin? They trace the trials and triumphs of the iconoclastic scientists who have sought to solve the mystery, from Darwin’s theory of evolution to Crick and Watson’s unveiling of DNA. This fascinating exploration not only examines the origin-of-life question, but also interrogates the very nature of scientific discovery and objectivity.

A Brief History Of Creation

Author : Bill Mesler
ISBN : 0393083551
Genre : Science
File Size : 38. 69 MB
Format : PDF, ePub
Download : 406
Read : 1175

Download Now


The epic story of the scientists through the ages who have sought answers to life s biggest mystery: How did it begin?"

Life As We Do Not Know It

Author : Peter Ward
ISBN : 9781440628566
Genre : Science
File Size : 63. 94 MB
Format : PDF, ePub, Mobi
Download : 473
Read : 357

Download Now


An engrossing and revelatory first look at the search for alien life—on Earth and beyond For the past twenty years, Peter Ward has been at the forefront of popular science writing, with books such as the influential and controversial Rare Earth. In Life as We Do Not Know It, Ward, with his signature blend of eloquence, humor, and learned insight, vividly details the latest scientific findings, cutting-edge research, and intrepid new theories on the subject of alien life and the possible extraterrestrial origins of life on Earth. In lucid, entertaining, and bold prose, Peter Ward once again challenges our notions of life on earth (and beyond).

Creation

Author : Adam Rutherford
ISBN : 9780141970226
Genre : Science
File Size : 74. 14 MB
Format : PDF, ePub, Mobi
Download : 898
Read : 773

Download Now


'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

Restless Creatures

Author : Matt Wilkinson
ISBN : 9781785780462
Genre : Science
File Size : 55. 15 MB
Format : PDF, Mobi
Download : 399
Read : 350

Download Now


A billion-year history of movement, from bacteria to Olympic athletes. 'Packed with revelations, scholarly but clear, Restless Creatures carries you from the kinetics of the amoeba to that of the blue whale, from the swim-cycle of spermatozoa, to why skipping works best on the moon. A pop-science treat.' Gavin Francis, author of Adventures in Human Being Despite the overwhelming diversity of life on earth, one theme has dominated its evolution: the apparently simple act of moving from one place to another. Restless Creatures is the first book for a general audience telling the incredible story of locomotion in human and animal evolution. Evolutionary biologist Matt Wilkinson traces this 4-billion-year history, showing why our ancestors became two-legged, how movement explains why we have opposable thumbs and a backbone, how fish fins became limbs, how even trees are locomotion-obsessed, and how movement has shaped our minds as well as our bodies. He explains why there are no flying monkeys or biological wheels, how dinosaurs took to the air, how Mexican waves were the making of the animal kingdom, and why moving can make us feel good. Restless Creatures opens up an astonishing new perspective – that little in evolution makes sense unless in the light of movement.

Paleontology

Author : Ian Tattersall
ISBN : 9781599473680
Genre : Religion
File Size : 65. 95 MB
Format : PDF, Kindle
Download : 657
Read : 276

Download Now


"Endlessly absorbing and informative. It would be hard to imagine a better introduction to this most important and fascinating field.”—Bill Bryson, author of A Short History of Nearly Everything Paleontology: A Brief History of Life is the fifth title published in the Templeton Science and Religion Series, in which scientists from a wide range of fields distill their experience and knowledge into brief tours of their respective specialties. In this volume, Ian Tattersall, a highly esteemed figure in the fields of anthropology, archaeology, and paleontology, leads a fascinating tour of the history of life and the evolution of human beings. Starting at the very beginning, Tattersall examines patterns of change in the biosphere over time, and the correlations of biological events with physical changes in the Earth’s environment. He introduces the complex of evolutionary processes, situates human beings in the luxuriant diversity of Life (demonstrating that however remarkable we may legitimately find ourselves to be, we are the product of the same basic forces and processes that have driven the evolutionary histories of all other creatures), and he places the origin of our extraordinary spiritual sensibilities in the context of the exaptational and emergent acquisition of symbolic cognition and thought. Concise and yet comprehensive, historically penetrating and yet up-to-date, responsibly factual and yet engaging, Paleontology serves as the perfect entrée to science's greatest story.

A Brief History Of Everyone Who Ever Lived

Author : Adam Rutherford
ISBN : 9780297609391
Genre : Science
File Size : 54. 40 MB
Format : PDF, Kindle
Download : 993
Read : 603

Download Now


This is a story about you. It is the history of who you are and how you came to be. It is unique to you, as it is to each of the 100 billion modern humans who have ever drawn breath. But it is also our collective story, because in every one of our genomes we each carry the history of our species - births, deaths, disease, war, famine, migration and a lot of sex. Since scientists first read the human genome in 2001 it has been subject to all sorts of claims, counterclaims and myths. In fact, as Adam Rutherford explains, our genomes should be read not as instruction manuals, but as epic poems. DNA determines far less than we have been led to believe about us as individuals, but vastly more about us as a species. In this captivating journey through the expanding landscape of genetics, Adam Rutherford reveals what our genes now tell us about history, and what history tells us about our genes. From Neanderthals to murder, from redheads to race, dead kings to plague, evolution to epigenetics, this is a demystifying and illuminating new portrait of who we are and how we came to be.

Creation

Author : Adam Rutherford
ISBN : 9781617230110
Genre : Science
File Size : 81. 17 MB
Format : PDF
Download : 625
Read : 256

Download Now


"How scientists are closer than ever to not only uncovering the mystery of how life was created, but to replicating that moment. Within the first billion years after this planet formed, a spark of life spontaneously ignited, turning inanimate chemicals into what we now would recognize as a living thing: a cell. Four billion years later, science has catalogued more than a million species. Science writer Adam Rutherford shows how unprecedented advances in our understanding of life have equipped us with the ability to create entirely new life-forms: goats that produce spider silk in their milk, bacteria that excrete diesel, genetic codes that identify and destroy cancer cells. This new synthetic biology is poised to offer radical new solutions to the crises of food shortage, pandemic disease, and climate change. By charting the history of our evolution, questioning what life really is, and identifying the milestones in our understanding of biological processes, Rutherford shows how this frontier of science will kickstart an industrial revolution that will dominate the rest of this century"--Provided by publisher.

The Stardust Revolution

Author : Jacob Berkowitz
ISBN : 9781616145507
Genre : Science
File Size : 87. 3 MB
Format : PDF, ePub, Docs
Download : 407
Read : 899

Download Now


Three great scientific revolutions have shaped our understanding of the cosmos and our relationship to it. The sixteenth and seventeenth centuries witnessed the Copernican Revolution, which bodychecked the Earth as the pivot point of creation and joined us with the rest of the cosmos as one planet among many orbiting the Sun. Three centuries later came the second great scientific revolution: the Darwinian Revolution. It removed us from a distinct, divine biological status to place us wholly in the ebb and flow of all terrestrial life. This book describes how we’re in the midst of a third great scientific revolution, five centuries in the making: the Stardust Revolution. It is the merging of the once-disparate realms of astronomy and evolutionary biology, and of the Copernican and Darwinian Revolutions, placing life in a cosmic context. The Stardust Revolution takes readers on a grand journey that begins on the summit of California’s Mount Wilson, where astronomers first realized that the universe is both expanding and evolving, to a radio telescope used to identify how organic molecules—the building blocks of life—are made by stars. It’s an epic story told through a scientific cast that includes some of the twentieth century’s greatest minds—including Nobel laureate Charles Townes, who discovered cosmic water—as well as the most ambitious scientific explorers of the twenty-first century, those racing to find another living planet. Today, an entirely new breed of scientists—astrobiologists and astrochemists—are taking the study of life into the space age. Astrobiologists study the origins, evolution, and distribution of life, not just on Earth, but in the universe. Stardust science is filling in the missing links in our evolutionary story, ones that extend our family tree back to the stars. From the Hardcover edition.

Origins Of Life

Author : Fazale Rana
ISBN : 1576833445
Genre : Religion
File Size : 70. 45 MB
Format : PDF, Mobi
Download : 196
Read : 1159

Download Now


Imagine primordial Earth, a churning cauldron of liquefied rock. Steaming, seething -- a vast desolate wasteland, inhospitable to life. Yet somehow first life appeared. Maybe chemicals in a primordial soup spontaneously spawned a single-celled creature that continued to evolve. Or perhaps a transcendent Creator formed and nurtured the initial life forms. To determine what really happened requires a framework to evaluate the evidence. For the first time in print, Dr. Rana and Dr. Ross present a scientific model for the creation of first life on Earth -- a model based on the Bible. They present testable predictions for this life-origins scenario and for the competing naturalistic scenarios. Which model withstands the rigorous scrutiny of science and the tests of time? The one that does gives insight to a deeper question: Why would the first life forms precede human life by billions of years? Book jacket.

Top Download:

Best Books