a brief history of creation science and the search for the origin of life

Download Book A Brief History Of Creation Science And The Search For The Origin Of Life in PDF format. You can Read Online A Brief History Of Creation Science And The Search For The Origin Of Life here in PDF, EPUB, Mobi or Docx formats.

A Brief History Of Creation

Author : Bill Mesler
ISBN : 0393083551
Genre : Science
File Size : 34. 26 MB
Format : PDF, Mobi
Download : 574
Read : 1047

Download Now


The epic story of the scientists through the ages who have sought answers to life s biggest mystery: How did it begin?"

A Brief History Of Creation Science And The Search For The Origin Of Life

Author : Bill Mesler
ISBN : 9780393248548
Genre : Science
File Size : 41. 23 MB
Format : PDF, Docs
Download : 172
Read : 1155

Download Now


The epic story of the scientists through the ages who have sought answers to life’s biggest mystery: How did it begin? How did life begin? It is perhaps the most important question science has ever asked. Over the centuries, the search for an answer has been entwined with some of science’s most revolutionary advances including van Leeuwenhoek’s microscope, Darwin’s theory of evolution, and Crick and Watson’s unveiling of DNA. Now, in an age of genetic engineering and space exploration, some scientists believe they are on the verge of creating life from nonliving elements and that our knowledge of the potential for life on other planets is ever-expanding. In the midst of these exciting developments, A Brief History of Creation provides an essential and illuminating history of Western science, tracing the trials and triumphs of the iconoclastic scientists who have sought to uncover the mystery of how life first came to be. Authors Bill Mesler and H. James Cleaves II examine historical discoveries in the context of philosophical debates, political change, and our evolving understanding of the complexity of biology. The story they tell is rooted in metaphysical arguments, in a changing understanding of the age of the Earth, and even in the politics of the Cold War. It has involved exploration into the inner recesses of our cells and scientific journeys to the farthest reaches of outer space. This elegantly written narrative culminates in an analysis of modern models for life’s genesis, such as the possibility that some of the earliest life was composed of little more than RNA, and that life arose around deep-sea hydrothermal vents or even on other planets, only to be carried to the Earth on meteorites. Can we ever conclusively prove how life began? A Brief History of Creation is a fascinating exploration not only of the origin-of-life question but of the very nature of scientific objectivity and the process of scientific discovery.

Creation

Author : Adam Rutherford
ISBN : 9780141970226
Genre : Science
File Size : 64. 54 MB
Format : PDF, Docs
Download : 940
Read : 984

Download Now


'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

A Brief History Of Everyone Who Ever Lived

Author : Adam Rutherford
ISBN : 9780297609391
Genre : Science
File Size : 25. 47 MB
Format : PDF
Download : 735
Read : 724

Download Now


This is a story about you. It is the history of who you are and how you came to be. It is unique to you, as it is to each of the 100 billion modern humans who have ever drawn breath. But it is also our collective story, because in every one of our genomes we each carry the history of our species - births, deaths, disease, war, famine, migration and a lot of sex. Since scientists first read the human genome in 2001 it has been subject to all sorts of claims, counterclaims and myths. In fact, as Adam Rutherford explains, our genomes should be read not as instruction manuals, but as epic poems. DNA determines far less than we have been led to believe about us as individuals, but vastly more about us as a species. In this captivating journey through the expanding landscape of genetics, Adam Rutherford reveals what our genes now tell us about history, and what history tells us about our genes. From Neanderthals to murder, from redheads to race, dead kings to plague, evolution to epigenetics, this is a demystifying and illuminating new portrait of who we are and how we came to be.

Origins

Author : Jim Baggott
ISBN : 9780191017346
Genre : Science
File Size : 47. 86 MB
Format : PDF, ePub, Docs
Download : 458
Read : 498

Download Now


What is the nature of the material world? How does it work? What is the universe and how was it formed? What is life? Where do we come from and how did we evolve? How and why do we think? What does it mean to be human? How do we know? There are many different versions of our creation story. This book tells the version according to modern science. It is a unique account, starting at the Big Bang and travelling right up to the emergence of humans as conscious intelligent beings, 13.8 billion years later. Chapter by chapter, it sets out the current state of scientific knowledge: the origins of space and time; energy, mass, and light; galaxies, stars, and our sun; the habitable earth, and complex life itself. Drawing together the physical and biological sciences, Baggott recounts what we currently know of our history, highlighting the questions science has yet to answer.

Sapiens

Author : Yuval Noah Harari
ISBN : 9780062316103
Genre : Science
File Size : 52. 95 MB
Format : PDF, Docs
Download : 453
Read : 251

Download Now


New York Times Bestseller From a renowned historian comes a groundbreaking narrative of humanity’s creation and evolution—a #1 international bestseller—that explores the ways in which biology and history have defined us and enhanced our understanding of what it means to be “human.” One hundred thousand years ago, at least six different species of humans inhabited Earth. Yet today there is only one—homo sapiens. What happened to the others? And what may happen to us? Most books about the history of humanity pursue either a historical or a biological approach, but Dr. Yuval Noah Harari breaks the mold with this highly original book that begins about 70,000 years ago with the appearance of modern cognition. From examining the role evolving humans have played in the global ecosystem to charting the rise of empires, Sapiens integrates history and science to reconsider accepted narratives, connect past developments with contemporary concerns, and examine specific events within the context of larger ideas. Dr. Harari also compels us to look ahead, because over the last few decades humans have begun to bend laws of natural selection that have governed life for the past four billion years. We are acquiring the ability to design not only the world around us, but also ourselves. Where is this leading us, and what do we want to become? Featuring 27 photographs, 6 maps, and 25 illustrations/diagrams, this provocative and insightful work is sure to spark debate and is essential reading for aficionados of Jared Diamond, James Gleick, Matt Ridley, Robert Wright, and Sharon Moalem.

A Short History Of Nearly Everything

Author : Bill Bryson
ISBN : 9781312792562
Genre : History
File Size : 61. 93 MB
Format : PDF
Download : 957
Read : 515

Download Now


In A Walk in the Woods, Bill Bryson trekked the Appalachian Trail—well, most of it. In A Sunburned Country, he confronted some of the most lethal wildlife Australia has to offer. Now, in his biggest book, he confronts his greatest challenge: to understand—and, if possible, answer—the oldest, biggest questions we have posed about the universe and ourselves. Taking as territory everything from the Big Bang to the rise of civilization, Bryson seeks to understand how we got from there being nothing at all to there being us. To that end, he has attached himself to a host of the world’s most advanced (and often obsessed) archaeologists, anthropologists, and mathematicians, travelling to their offices, laboratories, and field camps. He has read (or tried to read) their books, pestered them with questions, apprenticed himself to their powerful minds.

Top Download:

Best Books