a brief history of creation science and the search for the origin of life

Download Book A Brief History Of Creation Science And The Search For The Origin Of Life in PDF format. You can Read Online A Brief History Of Creation Science And The Search For The Origin Of Life here in PDF, EPUB, Mobi or Docx formats.

A Brief History Of Creation Science And The Search For The Origin Of Life

Author : Bill Mesler
ISBN : 9780393248548
Genre : Science
File Size : 53. 65 MB
Format : PDF, Mobi
Download : 502
Read : 741

Download Now


The epic story of the scientists through the ages who have sought answers to life’s biggest mystery: How did it begin? In this essential and illuminating history of Western science, Bill Mesler and H. James Cleaves II seek to answer the most crucial question in science: How did life begin? They trace the trials and triumphs of the iconoclastic scientists who have sought to solve the mystery, from Darwin’s theory of evolution to Crick and Watson’s unveiling of DNA. This fascinating exploration not only examines the origin-of-life question, but also interrogates the very nature of scientific discovery and objectivity.

A Brief History Of Creation

Author : Bill Mesler
ISBN : 0393083551
Genre : Science
File Size : 33. 72 MB
Format : PDF, ePub
Download : 670
Read : 654

Download Now


The epic story of the scientists through the ages who have sought answers to life s biggest mystery: How did it begin?"

Creation

Author : Adam Rutherford
ISBN : 9780141970226
Genre : Science
File Size : 21. 63 MB
Format : PDF, ePub, Mobi
Download : 627
Read : 1196

Download Now


'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

Restless Creatures

Author : Matt Wilkinson
ISBN : 9781785780462
Genre : Science
File Size : 28. 94 MB
Format : PDF, Mobi
Download : 761
Read : 485

Download Now


A billion-year history of movement, from bacteria to Olympic athletes. 'Packed with revelations, scholarly but clear, Restless Creatures carries you from the kinetics of the amoeba to that of the blue whale, from the swim-cycle of spermatozoa, to why skipping works best on the moon. A pop-science treat.' Gavin Francis, author of Adventures in Human Being Despite the overwhelming diversity of life on earth, one theme has dominated its evolution: the apparently simple act of moving from one place to another. Restless Creatures is the first book for a general audience telling the incredible story of locomotion in human and animal evolution. Evolutionary biologist Matt Wilkinson traces this 4-billion-year history, showing why our ancestors became two-legged, how movement explains why we have opposable thumbs and a backbone, how fish fins became limbs, how even trees are locomotion-obsessed, and how movement has shaped our minds as well as our bodies. He explains why there are no flying monkeys or biological wheels, how dinosaurs took to the air, how Mexican waves were the making of the animal kingdom, and why moving can make us feel good. Restless Creatures opens up an astonishing new perspective – that little in evolution makes sense unless in the light of movement.

A Brief History Of Everyone Who Ever Lived

Author : Adam Rutherford
ISBN : 9780297609391
Genre : Science
File Size : 82. 88 MB
Format : PDF, Kindle
Download : 803
Read : 269

Download Now


This is a story about you. It is the history of who you are and how you came to be. It is unique to you, as it is to each of the 100 billion modern humans who have ever drawn breath. But it is also our collective story, because in every one of our genomes we each carry the history of our species - births, deaths, disease, war, famine, migration and a lot of sex. Since scientists first read the human genome in 2001 it has been subject to all sorts of claims, counterclaims and myths. In fact, as Adam Rutherford explains, our genomes should be read not as instruction manuals, but as epic poems. DNA determines far less than we have been led to believe about us as individuals, but vastly more about us as a species. In this captivating journey through the expanding landscape of genetics, Adam Rutherford reveals what our genes now tell us about history, and what history tells us about our genes. From Neanderthals to murder, from redheads to race, dead kings to plague, evolution to epigenetics, this is a demystifying and illuminating new portrait of who we are and how we came to be.

Origins

Author : Jim Baggott
ISBN : 9780191017346
Genre : Science
File Size : 34. 51 MB
Format : PDF, Docs
Download : 910
Read : 511

Download Now


What is the nature of the material world? How does it work? What is the universe and how was it formed? What is life? Where do we come from and how did we evolve? How and why do we think? What does it mean to be human? How do we know? There are many different versions of our creation story. This book tells the version according to modern science. It is a unique account, starting at the Big Bang and travelling right up to the emergence of humans as conscious intelligent beings, 13.8 billion years later. Chapter by chapter, it sets out the current state of scientific knowledge: the origins of space and time; energy, mass, and light; galaxies, stars, and our sun; the habitable earth, and complex life itself. Drawing together the physical and biological sciences, Baggott recounts what we currently know of our history, highlighting the questions science has yet to answer.

The Big Picture

Author : Sean Carroll
ISBN : 9781780746074
Genre : Science
File Size : 74. 44 MB
Format : PDF, Kindle
Download : 866
Read : 1065

Download Now


Where are we? Who are we? Do our beliefs, hopes and dreams mean anything out there in the void? Can human purpose and meaning ever fit into a scientific worldview? Acclaimed award-winning author Sean Carroll brings his extraordinary intellect to bear on the realms of knowledge, the laws of nature and the most profound questions about life, death and our place in it all. In a dazzlingly unique presentation, Carroll takes us through the scientific revolution’s avalanche of discoveries, from Darwin and Einstein to the origins of life, consciousness and the universe itself. Delving into the way the world works at the quantum, cosmic and human levels, he reveals how human values relate to scientific reality. An extraordinary synthesis of cosmos-sprawling science and profound thought, The Big Picture is Carroll’s quest to explain our world. Destined to sit alongside the works of our greatest thinkers, from Stephen Hawking and Carl Sagan to Daniel Dennett and E. O. Wilson, this book shows that while our lives may be forever dwarfed by the immensity of the universe, they can be redeemed by our capacity to comprehend it and give it meaning.

Top Download:

Best Books