a brief history of creation science and the search for the origin of life

Download Book A Brief History Of Creation Science And The Search For The Origin Of Life in PDF format. You can Read Online A Brief History Of Creation Science And The Search For The Origin Of Life here in PDF, EPUB, Mobi or Docx formats.

A Brief History Of Creation Science And The Search For The Origin Of Life

Author : Bill Mesler
ISBN : 9780393248548
Genre : Science
File Size : 33. 46 MB
Format : PDF, ePub
Download : 389
Read : 262

Get This Book


The epic story of the scientists through the ages who have sought answers to life’s biggest mystery: How did it begin? In this essential and illuminating history of Western science, Bill Mesler and H. James Cleaves II seek to answer the most crucial question in science: How did life begin? They trace the trials and triumphs of the iconoclastic scientists who have sought to solve the mystery, from Darwin’s theory of evolution to Crick and Watson’s unveiling of DNA. This fascinating exploration not only examines the origin-of-life question, but also interrogates the very nature of scientific discovery and objectivity.

The Creation Hypothesis

Author : James Porter Moreland
ISBN : 0830816984
Genre : Religion
File Size : 49. 70 MB
Format : PDF, Docs
Download : 850
Read : 328

Get This Book


P.J. Moreland and a panel of scholars examine arguments and evidence from astronomy, physics, bio-chemistry, paleontology, and linguistics as they evaluate the creation hypothesis.

Handbook Of Astrobiology

Author : Vera M. Kolb
ISBN : 9781351661119
Genre : Science
File Size : 88. 19 MB
Format : PDF, Docs
Download : 704
Read : 1286

Get This Book


Read an exclusive interview with Professor Vera Kolb here. Astrobiology is the study of the origin, evolution, distribution, and future of life on Earth. This exciting and significant field of research also investigates the potential existence and search for extra-terrestrial life in the Solar System and beyond. This is the first handbook in this burgeoning and interdisciplinary field. Edited by Vera Kolb, a highly respected astrobiologist, this comprehensive resource captures the history and current state of the field. Rich in information and easy to use, it assumes basic knowledge and provides answers to questions from practitioners and specialists in the field, as well as providing key references for further study. Features: Fills an important gap in the market, providing a comprehensive overview of the field Edited by an authority in the subject, with chapters written by experts in the many diverse areas that comprise astrobiology Contains in-depth and broad coverage of an exciting field that will only grow in importance in the decades ahead

The Origins Of Life And The Universe

Author : Paul F. Lurquin
ISBN : 9780231507660
Genre : Science
File Size : 57. 40 MB
Format : PDF, ePub, Docs
Download : 193
Read : 285

Get This Book


The Origins of Life and the Universe is the culmination of a university science professor's search for understanding and is based on his experiences teaching the fundamental issues of physics, chemistry, and biology in the classroom. What is life? Where did it come from? How can understanding the origins of life on Earth help us understand the origins of the universe, and vice versa? These are questions that have occupied us all. This is a book, then, about the beginning of things—of the universe, matter, stars, and planetary systems, and finally, of life itself—topics of profound interest that are rarely considered together. After surveying prescientific accounts of the origins of life, the book examines the concepts of modern physics and cosmology, in particular the two pillars of modern physics, relativity and quantum theory, and how they can be applied to the Big Bang model of the creation of the universe. The author then considers molecular genetics and DNA, the famed building block of life. In addition to assessing various hypotheses concerning the appearance of the first bacterial cells and their evolution into more complex eukaryotic cells, this section explains how "protocells" may have started a kind of integrated metabolism and how horizontal gene transfer may have speeded up evolution. Finally, the book discusses the possibility that life did not originate on planet Earth but first appeared on other solar planets, or perhaps in other star systems. How would such a possibility affect our understanding of the meaning of life, or of its ultimate fate in the universe? The book ends as it begins, with profound questions and penetrating answers, a state-of-the-art guide to unlocking the scientific mysteries of life and matter.

Science And Earth History

Author : Arthur Newell Strahler
ISBN : PSU:000044308711
Genre : Religion
File Size : 89. 80 MB
Format : PDF, Mobi
Download : 893
Read : 1000

Get This Book


In this comprehensive treatment of the ongoing conflict between creationists and evolutionary scientists, well-known geomorphologist Arthur Strahler carefully examines creationists' claims of scientific evidence for the six-day divine creation of the universe, followed by the catastrophic flood of Noah, as claimed in Genesis. The creationists' arguments are examined and evaluated against the findings of mainstream science in the fields of cosmology, astronomy, geophysics, geology, paleontology, and evolutionary biology. Updated with a new preface and responses to recent attacks on evolutionary theory, Science and Earth History can serve as both a popular overview of earth history and as a scholarly anecdote to the fictions of creationism once again finding their way into classrooms and universities. Strahler illuminates the controversy by reviewing the philosophy, methodology, and sociology of empirical science, as contrasted with the belief systems of religion and pseudoscience. The author also includes lucid criteria for distinguishing science from pseudoscience, and reviews the great discoveries and developments in science that point to the evolution of life over the earth's three-billion-year history.

Origins

Author : Jim Baggott
ISBN : 9780192561978
Genre : Science
File Size : 29. 31 MB
Format : PDF, Mobi
Download : 624
Read : 421

Get This Book


What is life? Where do we come from and how did we evolve? What is the universe and how was it formed? What is the nature of the material world? How does it work? How and why do we think? What does it mean to be human? How do we know? There are many different versions of our creation story. This book tells the version according to modern science. It is a unique account, starting at the Big Bang and travelling right up to the emergence of humans as conscious intelligent beings, 13.8 billion years later. Chapter by chapter, it sets out the current state of scientific knowledge: the origins of space and time; energy, mass, and light; galaxies, stars, and our sun; the habitable earth, and complex life itself. Drawing together the physical and biological sciences, Baggott recounts what we currently know of our history, highlighting the questions science has yet to answer.

A Tear At The Edge Of Creation

Author : Marcelo Gleiser
ISBN : 9781439127865
Genre : Science
File Size : 85. 78 MB
Format : PDF, Kindle
Download : 372
Read : 995

Get This Book


For millennia, shamans and philosophers, believers and nonbelievers, artists and scientists have tried to make sense of our existence by suggesting that everything is connected, that a mysterious Oneness binds us to everything else. People go to temples, churches, mosques, and synagogues to pray to their divine incarnation of Oneness. Following a surprisingly similar notion, scientists have long asserted that under Nature’s apparent complexity there is a simpler underlying reality. In its modern incarnation, this Theory of Everything would unite the physical laws governing very large bodies (Einstein’s theory of relativity) and those governing tiny ones (quantum mechanics) into a single framework. But despite the brave efforts of many powerful minds, the Theory of Everything remains elusive. It turns out that the universe is not elegant. It is gloriously messy. Overturning more than twenty-five centuries of scientific thought, award-winning physicist Marcelo Gleiser argues that this quest for a Theory of Everything is fundamentally misguided, and he explains the volcanic implications this ideological shift has for humankind. All the evidence points to a scenario in which everything emerges from fundamental imperfections, primordial asymmetries in matter and time, cataclysmic accidents in Earth’s early life, and duplication errors in the genetic code. Imbalance spurs creation. Without asymmetries and imperfections, the universe would be filled with nothing but smooth radiation. A Tear at the Edge of Creation calls for nothing less than a new "humancentrism" to reflect our position in the universal order. All life, but intelligent life in particular, is a rare and precious accident. Our presence here has no meaning outside of itself, but it does have meaning. The unplanned complexity of humankind is all the more beautiful for its improbability. It’s time for science to let go of the old aesthetic that labels perfection beautiful and holds that "beauty is truth." It’s time to look at the evidence without centuries of monotheistic baggage. In this lucid, down-to-earth narrative, Gleiser walks us through the basic and cutting-edge science that fueled his own transformation from unifier to doubter—a fascinating scientific quest that led him to a new understanding of what it is to be human.

Creation

Author : Adam Rutherford
ISBN : 9780141970226
Genre : Science
File Size : 32. 37 MB
Format : PDF, Docs
Download : 734
Read : 1118

Get This Book


'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

Science Religion And The Search For Extraterrestrial Intelligence

Author : David Wilkinson
ISBN : 9780199680207
Genre : Nature
File Size : 84. 7 MB
Format : PDF, Kindle
Download : 525
Read : 792

Get This Book


This book is about the search for extraterrestrial intelligence, taking seriously the current scientific arguments and its implications for religion.

Understanding Scientific Theories Of Origins

Author : Robert C. Bishop
ISBN : 9780830891641
Genre : Religion
File Size : 35. 46 MB
Format : PDF, Docs
Download : 423
Read : 182

Get This Book


From five authors with over two decades of experience teaching origins together in the classroom, this is the first textbook to offer a full-fledged discussion of the scientific narrative of origins from the Big Bang through humankind, from biblical and theological perspectives. This work gives the reader a detailed picture of mainstream scientific theories of origins along with how they fit into the story of God's creative and redemptive action.

Top Download:

Best Books