the vital question energy evolution and the origins of complex life

Download Book The Vital Question Energy Evolution And The Origins Of Complex Life in PDF format. You can Read Online The Vital Question Energy Evolution And The Origins Of Complex Life here in PDF, EPUB, Mobi or Docx formats.

The Vital Question Energy Evolution And The Origins Of Complex Life

Author : Nick Lane
ISBN : 9780393248197
Genre : Science
File Size : 61. 15 MB
Format : PDF, Kindle
Download : 910
Read : 504

Get This Book


“One of the deepest, most illuminating books about the history of life to have been published in recent years.” —The Economist The Earth teems with life: in its oceans, forests, skies and cities. Yet there’s a black hole at the heart of biology. We do not know why complex life is the way it is, or, for that matter, how life first began. In The Vital Question, award-winning author and biochemist Nick Lane radically reframes evolutionary history, putting forward a solution to conundrums that have puzzled generations of scientists. For two and a half billion years, from the very origins of life, single-celled organisms such as bacteria evolved without changing their basic form. Then, on just one occasion in four billion years, they made the jump to complexity. All complex life, from mushrooms to man, shares puzzling features, such as sex, which are unknown in bacteria. How and why did this radical transformation happen? The answer, Lane argues, lies in energy: all life on Earth lives off a voltage with the strength of a lightning bolt. Building on the pillars of evolutionary theory, Lane’s hypothesis draws on cutting-edge research into the link between energy and cell biology, in order to deliver a compelling account of evolution from the very origins of life to the emergence of multicellular organisms, while offering deep insights into our own lives and deaths. Both rigorous and enchanting, The Vital Question provides a solution to life’s vital question: why are we as we are, and indeed, why are we here at all?

The Vital Question

Author : Nick Lane
ISBN : 9781847658807
Genre : Science
File Size : 81. 52 MB
Format : PDF, Kindle
Download : 179
Read : 189

Get This Book


Why is life the way it is? Bacteria evolved into complex life just once in four billion years of life on earth-and all complex life shares many strange properties, from sex to ageing and death. If life evolved on other planets, would it be the same or completely different? In The Vital Question, Nick Lane radically reframes evolutionary history, putting forward a cogent solution to conundrums that have troubled scientists for decades. The answer, he argues, lies in energy: how all life on Earth lives off a voltage with the strength of a bolt of lightning. In unravelling these scientific enigmas, making sense of life's quirks, Lane's explanation provides a solution to life's vital questions: why are we as we are, and why are we here at all? This is ground-breaking science in an accessible form, in the tradition of Charles Darwin's The Origin of Species, Richard Dawkins' The Selfish Gene, and Jared Diamond's Guns, Germs and Steel.

Perspectives

Author : William F Brown
ISBN : 9781460270301
Genre : Education
File Size : 71. 35 MB
Format : PDF
Download : 918
Read : 330

Get This Book


From the first seconds Following the Big Bang, to our best guesses for the fate of the universe and humanity, science provides stunning new perspectives about the place of humanity in the cosmos. Humans may live on one planet in one small corner of the Milky Way, itself one of billions of other galaxies, but Earth may be unique in one respect. Earth is teaming with life, one species of which, through chance and natural selection, developed an extraordinary brain, gifted with imagination, curiosity and a compulsion to understand ourselves and the universe. Perspectives is a journey through deep time, from the creation of the universe to the beginnings of life, our human origins and later the rise of culture and religion. It explores what it means to be human, and where our technology could take us in the years and centuries to come....

Christian Ministry In The Divine Milieu

Author : Maldari, SJ, Donald, C.
ISBN : 9781608337743
Genre : Religion
File Size : 20. 30 MB
Format : PDF
Download : 820
Read : 1142

Get This Book


Fr. Maldari offers a vision of Christian ministry as a community in which each member actively participates in fostering creation's evolution toward fulfillment. While ministry is ultimately cooperating with God in furthering the process of creation to its fulfillment in salvation, it also humbly recognizes human limitation and dependence upon the Holy Spirit.

Quarks To Culture

Author : Tyler Volk
ISBN : 9780231544139
Genre : Science
File Size : 83. 32 MB
Format : PDF, Docs
Download : 692
Read : 1328

Get This Book


Our world is nested, both physically and socially, and at each level we find innovations that are necessary for the next. Consider: atoms combine to form molecules, molecules combine to form single-celled organisms; when people come together, they build societies. Physics has gone far in mapping the basic mechanics of the simplest things and the dynamics of the overall nesting, as have biology and the social sciences for their fields. But what can we say about this beautifully complex whole? How does one stage shape another, and what can we learn about human existence through understanding an enlarged field of creation and being? In Quarks to Culture, Tyler Volk answers these questions, revealing how a universal natural rhythm—building from smaller things into larger, more complex things—resulted in a grand sequence of twelve fundamental levels across the realms of physics, biology, and culture. He introduces the key concept of “combogenesis,” the building-up from combination and integration to produce new things with innovative relations. He explores common themes in how physics and chemistry led to biological evolution, and biological evolution to cultural evolution. Volk also provides insights into linkages across the sciences and fields of scholarship, and presents an exciting synthesis of ideas along a sequence of things and relations, from physical to living to cultural. The resulting inclusive natural philosophy brings clarity to our place in the world, offering a roadmap for those who seek to understand big history and wrestle with questions of how we came to be.

Life Ascending

Author : Nick Lane
ISBN : 9781847652225
Genre : Science
File Size : 66. 80 MB
Format : PDF, Mobi
Download : 861
Read : 994

Get This Book


Winner of the 2010 Royal Society Prize for science books Powerful new research methods are providing fresh and vivid insights into the makeup of life. Comparing gene sequences, examining the atomic structure of proteins and looking into the geochemistry of rocks have all helped to explain creation and evolution in more detail than ever before. Nick Lane uses the full extent of this new knowledge to describe the ten greatest inventions of life, based on their historical impact, role in living organisms today and relevance to current controversies. DNA, sex, sight and consciousnesses are just four examples. Lane also explains how these findings have come about, and the extent to which they can be relied upon. The result is a gripping and lucid account of the ingenuity of nature, and a book which is essential reading for anyone who has ever questioned the science behind the glories of everyday life.

Creation

Author : Adam Rutherford
ISBN : 9780141970226
Genre : Science
File Size : 66. 15 MB
Format : PDF, ePub, Mobi
Download : 128
Read : 357

Get This Book


'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

The International Standard Bible Encyclopaedia

Author : James Orr
ISBN : MINN:31951D003869642
Genre : Bible
File Size : 84. 21 MB
Format : PDF, Docs
Download : 527
Read : 803

Get This Book



The International Standard Bible Encyclopedia

Author : James Orr
ISBN : PSU:000010274545
Genre : Religion
File Size : 23. 24 MB
Format : PDF, ePub, Mobi
Download : 962
Read : 683

Get This Book



Work And Wealth Routledge Revivals

Author : J. A. Hobson
ISBN : 9781136857287
Genre : Business & Economics
File Size : 75. 75 MB
Format : PDF, Docs
Download : 478
Read : 932

Get This Book


First published in 1914 and reissued with a new introduction in 1992, Work and Wealth is a seminal vision of Hobson's liberal utopian ideals, which desired to demonstrate how economic and social reform could transform existing society into one in which the majority of the population, as opposed to a small elite, could find fulfillment. Hobson attacked conventional economic wisdom which made a division between the cost of production and the utility derived from consumption. Far from being necesarily arduous, Hobson argued that work had the potential to bring about immense utility and enrichment. The qualitative, humanist work argues in favour of a new form of capitalism to minimise cost and maximise utility.

Top Download:

Best Books