the vital question energy evolution and the origins of complex life

Download Book The Vital Question Energy Evolution And The Origins Of Complex Life in PDF format. You can Read Online The Vital Question Energy Evolution And The Origins Of Complex Life here in PDF, EPUB, Mobi or Docx formats.

The Vital Question

Author : Nick Lane
ISBN : 0393352978
Genre : Science
File Size : 43. 30 MB
Format : PDF, ePub, Docs
Download : 962
Read : 1138

Get This Book

One of the deepest, most illuminating books about the history of life to have been published in recent years. The Economist"


Author : William F Brown
ISBN : 9781460270301
Genre : Education
File Size : 88. 32 MB
Format : PDF, Mobi
Download : 575
Read : 468

Get This Book

From the first seconds Following the Big Bang, to our best guesses for the fate of the universe and humanity, science provides stunning new perspectives about the place of humanity in the cosmos. Humans may live on one planet in one small corner of the Milky Way, itself one of billions of other galaxies, but Earth may be unique in one respect. Earth is teaming with life, one species of which, through chance and natural selection, developed an extraordinary brain, gifted with imagination, curiosity and a compulsion to understand ourselves and the universe. Perspectives is a journey through deep time, from the creation of the universe to the beginnings of life, our human origins and later the rise of culture and religion. It explores what it means to be human, and where our technology could take us in the years and centuries to come....

Christian Ministry In The Divine Milieu

Author : Maldari, SJ, Donald, C.
ISBN : 9781608337743
Genre : Religion
File Size : 56. 79 MB
Format : PDF, ePub
Download : 904
Read : 1173

Get This Book

Fr. Maldari offers a vision of Christian ministry as a community in which each member actively participates in fostering creation's evolution toward fulfillment. While ministry is ultimately cooperating with God in furthering the process of creation to its fulfillment in salvation, it also humbly recognizes human limitation and dependence upon the Holy Spirit.

Quarks To Culture

Author : Tyler Volk
ISBN : 9780231544139
Genre : Science
File Size : 83. 70 MB
Format : PDF
Download : 310
Read : 955

Get This Book

Our world is nested, both physically and socially, and at each level we find innovations that are necessary for the next. Consider: atoms combine to form molecules, molecules combine to form single-celled organisms; when people come together, they build societies. Physics has gone far in mapping the basic mechanics of the simplest things and the dynamics of the overall nesting, as have biology and the social sciences for their fields. But what can we say about this beautifully complex whole? How does one stage shape another, and what can we learn about human existence through understanding an enlarged field of creation and being? In Quarks to Culture, Tyler Volk answers these questions, revealing how a universal natural rhythm—building from smaller things into larger, more complex things—resulted in a grand sequence of twelve fundamental levels across the realms of physics, biology, and culture. He introduces the key concept of “combogenesis,” the building-up from combination and integration to produce new things with innovative relations. He explores common themes in how physics and chemistry led to biological evolution, and biological evolution to cultural evolution. Volk also provides insights into linkages across the sciences and fields of scholarship, and presents an exciting synthesis of ideas along a sequence of things and relations, from physical to living to cultural. The resulting inclusive natural philosophy brings clarity to our place in the world, offering a roadmap for those who seek to understand big history and wrestle with questions of how we came to be.

The Sage Encyclopedia Of Business Ethics And Society

Author : Robert W. Kolb
ISBN : 9781483381541
Genre : Business & Economics
File Size : 77. 49 MB
Format : PDF, Mobi
Download : 211
Read : 1122

Get This Book

Thoroughly revised, updated, and expanded, The SAGE Encyclopedia of Business Ethics and Society, Second Edition explores current topics, such as mass social media, cookies, and cyber-attacks, as well as traditional issues including accounting, discrimination, environmental concerns, and management. The new edition also includes an in-depth examination of current and recent ethical affairs, such as the dangerous work environments of off-shore factories for Western retailers, the negligence resulting in the 2010 BP oil spill, the gender wage gap, the minimum wage debate and increasing income disparity, and the unparalleled level of debt in the U.S. and other countries with the challenges it presents to many societies and the considerable impact on the ethics of intergenerational wealth transfers. Key Features Include: Seven volumes, available in both electronic and print formats, contain more than 1,200 signed entries by significant figures in the field Cross-references and suggestions for further readings to guide students to in-depth resources Thematic Reader's Guide groups related entries by general topics Index allows for thorough browse-and-search capabilities in the electronic edition

Life Ascending

Author : Nick Lane
ISBN : 9781847652225
Genre : Science
File Size : 21. 28 MB
Format : PDF, Mobi
Download : 237
Read : 1273

Get This Book

Winner of the 2010 Royal Society Prize for science books Powerful new research methods are providing fresh and vivid insights into the makeup of life. Comparing gene sequences, examining the atomic structure of proteins and looking into the geochemistry of rocks have all helped to explain creation and evolution in more detail than ever before. Nick Lane uses the full extent of this new knowledge to describe the ten greatest inventions of life, based on their historical impact, role in living organisms today and relevance to current controversies. DNA, sex, sight and consciousnesses are just four examples. Lane also explains how these findings have come about, and the extent to which they can be relied upon. The result is a gripping and lucid account of the ingenuity of nature, and a book which is essential reading for anyone who has ever questioned the science behind the glories of everyday life.


Author : Adam Rutherford
ISBN : 9780141970226
Genre : Science
File Size : 55. 20 MB
Format : PDF, ePub, Docs
Download : 287
Read : 899

Get This Book

'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

Clay Minerals And The Origin Of Life

Author : Clay Minerals and the Origin O
ISBN : 0521324084
Genre : Science
File Size : 62. 57 MB
Format : PDF, ePub
Download : 557
Read : 1003

Get This Book

This volume is the edited proceedings of a conference seeking to clarify the possible role of clays in the origin of life on Earth. At the heart of the problem of the origin of life lie fundamental questions such as: What kind of properties is a model of a primitive living system required to exhibit and what would its most plausible chemical and molecular makeup be? Answers to these questions have traditionally been sought in terms of properties that are held to be common to all contemporary organisms. However, there are a number of different ideas both on the nature and on the evolutionary priority of 'common vital properties', notably those based on protoplasmic, biochemical and genetic theories of life. This is therefore the first area for consideration in this volume and the contributors then examine to what extent the properties of clay match those required by the substance which acted as the template for life.

Work And Wealth Routledge Revivals

Author : J. A. Hobson
ISBN : 9781136857287
Genre : Business & Economics
File Size : 55. 73 MB
Format : PDF, Kindle
Download : 191
Read : 417

Get This Book

First published in 1914 and reissued with a new introduction in 1992, Work and Wealth is a seminal vision of Hobson's liberal utopian ideals, which desired to demonstrate how economic and social reform could transform existing society into one in which the majority of the population, as opposed to a small elite, could find fulfillment. Hobson attacked conventional economic wisdom which made a division between the cost of production and the utility derived from consumption. Far from being necesarily arduous, Hobson argued that work had the potential to bring about immense utility and enrichment. The qualitative, humanist work argues in favour of a new form of capitalism to minimise cost and maximise utility.

Epic Of Evolution

Author : Eric J. Chaisson
ISBN : 9780231509602
Genre : Science
File Size : 32. 32 MB
Format : PDF
Download : 948
Read : 1011

Get This Book

How did everything around us-the air, the land, the sea, and the stars-originate? What is the source of order, form, and structure characterizing all material things? These are just some of the grand scientific questions Eric J. Chaisson, author of the classic work Cosmic Dawn, explores in his enthralling and illuminating history of the universe. Explaining new discoveries and a range of cutting-edge ideas and theories, Chaisson provides a creative and coherent synthesis of current scientific thinking on the universe's beginnings. He takes us on a tour of the seven ages of the cosmos, from the formless era of radiation through the origins of human culture. Along the way he examines the development of the most microscopic and the most immense aspects of our universe and the complex ways in which they interact. Drawing on recent breakthroughs in astrophysics and biochemistry, Chaisson discusses the contemporary scientific view that all objects-from quarks and quasars to microbes and the human mind-are interrelated. Researchers in all the natural sciences are beginning to identify an underlying pattern penetrating the fabric of existence-a sweepingly encompassing view of the formation, structure, and function of all objects in our multitudinous universe. Moreover, as Chaisson demonstrates, by deciphering the scenario of cosmic evolution, scientists can also determine how living organisms managed to inhabit the land, generate language, and create culture. Epic of Evolution offers a stunning view of how various changes, operating across almost incomprehensible domains of space and nearly inconceivable stretches of time and through the evolutionary combination of necessity and chance, have given rise to our galaxy, our star, our planet, and ourselves.

Top Download:

Best Books